View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15087_high_4 (Length: 478)
Name: NF15087_high_4
Description: NF15087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15087_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 176 - 465
Target Start/End: Original strand, 5752456 - 5752745
Alignment:
| Q |
176 |
aaataattgaatgccaaaccgcatggaggagagttgtttcccttgctgtcaattcaggtatcagcatcccaggtatgtatgctagtcttgcatattttga |
275 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
5752456 |
aaataattgaacgccaaaccgcatggaggagagttgtttcccttgctgtcaattcaggtatcagcctcccgggtatgtctgctagtcttgcatattttga |
5752555 |
T |
 |
| Q |
276 |
cacttatagaagggaaaggttgccacctaatttggtgcgagctcaacgagactacttcggtgctcatacatatgaaagggttgatatcgaggggtcgtac |
375 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5752556 |
ctcttatagaagggaaaggttgccagctaatttggtgcaagctcaacgagactacttcggtgctcatacatatgaaagggttgatatcgaggggtcgtac |
5752655 |
T |
 |
| Q |
376 |
catactaaatggttcaaacttgccaagaagttgaggatttagattactgtatttgaactcttcaagattcctaataaatgtaatgttttt |
465 |
Q |
| |
|
|||||| |||||||||| ||||||||| ||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5752656 |
catactgaatggttcaagcttgccaagcagtcgaggatttagattactgtgtttgaactcttcaagattcctaataaatgtaatgttttt |
5752745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 339 - 465
Target Start/End: Original strand, 5756533 - 5756659
Alignment:
| Q |
339 |
tcatacatatgaaagggttgatatcgaggggtcgtaccatactaaatggttcaaacttgccaagaagttgaggatttagattactgtatttgaactcttc |
438 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||| |||||||||| ||| ||| ||| ||||||||||||| ||||| ||||||||||| |
|
|
| T |
5756533 |
tcatacatatgaaagggttgatatcgacgggtcttaccatactgaatggttcaagcttttaaagcagtcgaggatttagatttctgtagttgaactcttc |
5756632 |
T |
 |
| Q |
439 |
aagattcctaataaatgtaatgttttt |
465 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5756633 |
aagattcctaataaatgtaatgttttt |
5756659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 5752275 - 5752355
Alignment:
| Q |
20 |
gggatgaatctgatcagtgcaaagagcactgaaaagggatgggatttggcattgggtgaacttgcccgtatttggaaagga |
100 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5752275 |
gggatgaatctgatccgtgcaaagagtgctgaaaagggttgggatttggaattgggtgaacttgcccgtatttggaaagga |
5752355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 5752399 - 5752452
Alignment:
| Q |
108 |
cgtacgacagaa-ccctaatcttacaaaccttcttgtggatccaaagttcgcaa |
160 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
5752399 |
cgtacgacagaaaccctaatctcgctaaccttcttgtggatccagagttcgcaa |
5752452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 280 - 353
Target Start/End: Original strand, 6078984 - 6079057
Alignment:
| Q |
280 |
tatagaagggaaaggttgccacctaatttggtgcgagctcaacgagactacttcggtgctcatacatatgaaag |
353 |
Q |
| |
|
|||||||||||||| |||||| | |||||||| | ||||||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
6078984 |
tatagaagggaaagattgccagcaaatttggtccaagctcaaagagattactttggtgctcatacatatgaaag |
6079057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University