View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1508_high_17 (Length: 332)
Name: NF1508_high_17
Description: NF1508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1508_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 51039565 - 51039734
Alignment:
| Q |
18 |
acatacaagattgaggatgagagatgccaaaatgttgatgtcatcatattgaaagtgtgaaaaacatttcaagcatgcatgaaatttcagcttgagatat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51039565 |
acatacaagattgaggatgagagatgccaaaatgttgatgtcatcatattgaaagtgtgaaaaacatttcaagtatgcatgaaatttcagcttgagatat |
51039664 |
T |
|
| Q |
118 |
gataattgaagctactccgtctagaatccaggacaagaggtccattgatttatgtttcagatacaatact |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51039665 |
gataattgaagctactccgtctagaatccaggacaagaggtccattgatttatgtttcagatacaatact |
51039734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 257 - 325
Target Start/End: Original strand, 51039795 - 51039863
Alignment:
| Q |
257 |
tatttgattttgttatcgatgtgctgtgttctgtgggtcgtcattatgctctttgcgttgcctttgctt |
325 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
51039795 |
tatttgatttagttatcgatgtgctgtgttttgtgggtcgtcattctgctctttgcgttgtctttgctt |
51039863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University