View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1508_high_23 (Length: 274)
Name: NF1508_high_23
Description: NF1508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1508_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 45953563 - 45953304
Alignment:
| Q |
1 |
ttcaattttgtgatttgaagacttggaatgagaaagattgtacatgttgagaagtccttcattggatgagatatgatctgaaaaagtgtttacaagtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45953563 |
ttcaattttgtgatttgaagacttggaatgagaaagattgtacatgttgagaagtccttcattggatgagatatgatctgaaaaagtgtttacaagtggt |
45953464 |
T |
|
| Q |
101 |
agacagtcctcatgttactgctgattttgcagcggttctctttggccatgcttcagatgcattgatcacttttttatcactaggaactttgtaaatgctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45953463 |
agacagtcctcatgttactgctgattttgaagcggttctctttggccatgcttcagatgcattgatcacttttttatcactaggaactttgtaaatgctt |
45953364 |
T |
|
| Q |
201 |
gccttctaggttgcttttgaagattaacatgacagtacgcaagtttatgcattatggtta |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45953363 |
gccttctaggttgcttttgaagattaacatgacagtacgcaagtttatgcattatggtta |
45953304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 110
Target Start/End: Original strand, 1221628 - 1221678
Alignment:
| Q |
60 |
cattggatgagatatgatctgaaaaagtgtttacaagtggtagacagtcct |
110 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| ||||||| |||| |||| |
|
|
| T |
1221628 |
cattggatgagatatgatctgagaatgtgtttataagtggtggacaatcct |
1221678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University