View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1508_high_26 (Length: 252)
Name: NF1508_high_26
Description: NF1508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1508_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 32545735 - 32545983
Alignment:
| Q |
1 |
ttgtgcaaaattctgaatctggggttaattggtttcattaatattcaacgtgggtctaatttgtttaatcaaatgcaccnnnnnnnttagaactttgtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32545735 |
ttgtgcaaaattctgaatctggggttaattggtttcattaatattcaacgtgggtctaatttgtttaatcaaatgcaccaaaaaaattagaactttgtga |
32545834 |
T |
 |
| Q |
101 |
gtgnnnnnnnnncat-ttgcgttattttatttcttcaaaggtaaattgcaatgttaatcacaatggtcaccacatatgagtgtctgtgacttttgatgtt |
199 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32545835 |
gtgaaaaaaaaaaaaattgcgttattttatttcttcaaaggtaaattgcaatgttaatcacaatggtcaccacatatgagtgtctgtgacttttgatgtt |
32545934 |
T |
 |
| Q |
200 |
tacattagcaaagtattctgcgaccaatttgtattttaagaattatcta |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32545935 |
tacattagcaaagtattctgcgaccaatttgtattttaagatttatcta |
32545983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University