View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1508_high_34 (Length: 215)
Name: NF1508_high_34
Description: NF1508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1508_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 10 - 155
Target Start/End: Complemental strand, 21156735 - 21156590
Alignment:
| Q |
10 |
aagaatatgtgaaactataatggattgtggatgtttgaatacaactgtagcacctgctatgctttgtgttttgtttaaatcatattatttgttataactc |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21156735 |
aagaaaatgtgaaactataatggattgtggatgtttgaatacaactgtagcacctgctatgctttgtgttttgtttaaatcatattacttgttataactc |
21156636 |
T |
 |
| Q |
110 |
atcgttgtccaccatttttgtgtttgcaagaccaaataaaatagac |
155 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21156635 |
attgttgtccaccatttttgtgtttgcaagaccaaatcaaatagac |
21156590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 199
Target Start/End: Complemental strand, 21156560 - 21156523
Alignment:
| Q |
162 |
tgaatgcactaatcttcacaaaattttgctcaaatctg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21156560 |
tgaatgcactaatcttcacaaaattttgctcaaatctg |
21156523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 10 - 155
Target Start/End: Complemental strand, 4117446 - 4117301
Alignment:
| Q |
10 |
aagaatatgtgaaactataatggattgtggatgtttgaatacaactgtagcacctgctatgctttgtgttttgtttaaatcatattatttgttataactc |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4117446 |
aagaaaatgtgaaactataatggattgtggatgtttgaatataactgtagcacctgctatgctttgtgttttgtttaaatcatattatttgttataactc |
4117347 |
T |
 |
| Q |
110 |
atcgttgtccaccatttttgtgtttgcaagaccaaataaaatagac |
155 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4117346 |
attgttgtccaccatttttgtgtttgcaagaccaaatcaaatagac |
4117301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 160 - 199
Target Start/End: Complemental strand, 4117270 - 4117231
Alignment:
| Q |
160 |
tttgaatgcactaatcttcacaaaattttgctcaaatctg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4117270 |
tttgaatgcactaatcttcacaaaattttgctcaaatctg |
4117231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University