View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1508_low_15 (Length: 396)
Name: NF1508_low_15
Description: NF1508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1508_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 18 - 386
Target Start/End: Complemental strand, 49003140 - 49002770
Alignment:
| Q |
18 |
gatacaaacaatgacaatttagaattaggccatttgatcgttcaagaatgctccaaagggaggcttcgtgctcgtgttgtaactgctgcagttggggatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49003140 |
gatacaaacaatgacaatttagaattaggccatttgatcgttcaagaatgctccaaagggaggcttcgtgctcgtgttgtagctgctgcagttggggatc |
49003041 |
T |
|
| Q |
118 |
atcaagatcattcctacaagttttcaaaggggcagagtttaaggccaattcaagaacatagcgaagatgtgtaggtgacaagaatggtgttgtagcttaa |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49003040 |
atcatgatcattcctacaagttttcaaaggggcagagtttaaggccaattcaagaacatagcgaagatgtgtaggtgacaagaatggtgttgtagcttaa |
49002941 |
T |
|
| Q |
218 |
acattttcttttac--nnnnnnnnnnnnnaatgtttaaattctaaaaaatttaaccaaaacaatttagtttgtttgccagtaacttagtccctttttaat |
315 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49002940 |
acattttcttttacctctctctctctctcaatgtttaaattctaaaaaattgaaccaaaacaatttagtttgtttgcctgtaacttagtccctttttaat |
49002841 |
T |
|
| Q |
316 |
cattgtaaaagactaaattattgccttctaattattgttatacaactaattgtcttttttacgtggttcat |
386 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49002840 |
cattgtaaaagactaaattattgccttttaattattgttatacaactaattgtcttttttacgtggttcat |
49002770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University