View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1508_low_17 (Length: 353)
Name: NF1508_low_17
Description: NF1508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1508_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 270
Target Start/End: Complemental strand, 5129840 - 5129589
Alignment:
| Q |
18 |
tatataggtgtgcaaattttaatctgcgagaaagaaatgaagatcttcaatatgactcttgacaggtaccctcctccggtgagacttttgatgaaagagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5129840 |
tatataggtgtgcaaattttaatctgcgagaaagaaatgaagatctttaatatgactcttgacaggtaccctcctccggtgagacttttgatgaaagagt |
5129741 |
T |
|
| Q |
118 |
acaactgaaatgaagcaacttccatacaataggtagggttatgaaagttcttgttttaggatgcaaatgatgtcttttctttttattgtaaaatttaatc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
5129740 |
acaactgaaatgaagcaacttccatacaataggtagggttatgaaagttcttgttttaggatgaaaatgatgtcttttcttttt-ttgtaaactttaatc |
5129642 |
T |
|
| Q |
218 |
tctgttcattagtcattatctatggttttcggagaatgacttgctaccttgtt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5129641 |
tctgttcattagtcattatctatggttttcagagaatgacttgctaccttgtt |
5129589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 299 - 344
Target Start/End: Complemental strand, 5129567 - 5129522
Alignment:
| Q |
299 |
tttatcattcagtttcctgatgtcttatatatgcttttcttcatct |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5129567 |
tttatcattcagtttcctgatgtcttatatatgcttttcttcatct |
5129522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University