View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1508_low_40 (Length: 207)
Name: NF1508_low_40
Description: NF1508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1508_low_40 |
 |  |
|
| [»] scaffold0041 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 181; Significance: 5e-98; HSPs: 3)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 87369 - 87553
Alignment:
| Q |
1 |
tatggagtcaaagaagaaatttaaaaatgtgaacaagagtgtggaccctcagctatggcatgccgttgcaggaggaatggttcaaatgccagaagttaac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
87369 |
tatggagtcaaagaagaaattgaaaaatgtgaacaagagtgtggaccctcagctatggcatgccgttgcaggaggaatggttcaaatgccagaagttaac |
87468 |
T |
 |
| Q |
101 |
tcacaggtcttctacttccctcagggtcacgccgagcatgcttgtgagcctgtgaatttcagttcttactccaaaattccgtctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
87469 |
tcacaggtcttctacttccctcagggtcacgccgagcatgcttgtgagcctgtgaatttcagttcttactccaaaattccgtctt |
87553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 56 - 185
Target Start/End: Original strand, 95440 - 95569
Alignment:
| Q |
56 |
tggcatgccgttgcaggaggaatggttcaaatgccagaagttaactcacaggtcttctacttccctcagggtcacgccgagcatgcttgtgagcctgtga |
155 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
95440 |
tggcatgccattgcaggaggaatggtgcaaatgccagaagttaactcacaggtcttttacttccctcagggtcacgccgagcatgcttgtgagccggtga |
95539 |
T |
 |
| Q |
156 |
atttcagttcttactccaaaattccgtctt |
185 |
Q |
| |
|
|||||||| |||||||||||||||| |||| |
|
|
| T |
95540 |
atttcagtgcttactccaaaattccatctt |
95569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 95399 - 95442
Alignment:
| Q |
1 |
tatggagtcaaagaagaaatttaaaaatgtgaacaagagtgtgg |
44 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
95399 |
tatggagtcaaaaaagaaattgaaaaatgtgaacaagagtgtgg |
95442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 181; Significance: 5e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 40878914 - 40878730
Alignment:
| Q |
1 |
tatggagtcaaagaagaaatttaaaaatgtgaacaagagtgtggaccctcagctatggcatgccgttgcaggaggaatggttcaaatgccagaagttaac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40878914 |
tatggagtcaaagaagaaattgaaaaatgtgaacaagagtgtggaccctcagctatggcatgccgttgcaggaggaatggttcaaatgccagaagttaac |
40878815 |
T |
 |
| Q |
101 |
tcacaggtcttctacttccctcagggtcacgccgagcatgcttgtgagcctgtgaatttcagttcttactccaaaattccgtctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40878814 |
tcacaggtcttctacttccctcagggtcacgccgagcatgcttgtgagcctgtgaatttcagttcttactccaaaattccgtctt |
40878730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 40870883 - 40870713
Alignment:
| Q |
1 |
tatggagtcaaagaagaaatttaaaaatgtgaacaagagtgtggaccctcagctatggcatgccgttgcaggaggaatggttcaaatgccagaagttaac |
100 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
40870883 |
tatggagtcaaaaaagaaattgaaaaatgtgaacaagagtg--------------tggcatgccattgcaggaggaatggtgcaaatgccagaagttaac |
40870798 |
T |
 |
| Q |
101 |
tcacaggtcttctacttccctcagggtcacgccgagcatgcttgtgagcctgtgaatttcagttcttactccaaaattccgtctt |
185 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
40870797 |
tcacaggtcttttacttccctcagggtcacgccgagcatgcttgtgagccggtgaatttcagtgcttactccaaaattccatctt |
40870713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University