View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509-Insertion-10 (Length: 256)
Name: NF1509-Insertion-10
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509-Insertion-10 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 77 - 116
Target Start/End: Complemental strand, 3606697 - 3606658
Alignment:
| Q |
77 |
ggttcatcttcctccctccctcatattctttatcatcttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3606697 |
ggttcatcttcctccctccctcatattctttatcatcttc |
3606658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 219 - 256
Target Start/End: Complemental strand, 3604484 - 3604447
Alignment:
| Q |
219 |
cattatttcgatgcccatttatgaatttccatcttgga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3604484 |
cattatttcgatgcccatttatgaatttttatcttgga |
3604447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 219 - 256
Target Start/End: Original strand, 40739129 - 40739166
Alignment:
| Q |
219 |
cattatttcgatgcccatttatgaatttccatcttgga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40739129 |
cattatttcgatgcccatttatgaatttccatcttgga |
40739166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 77 - 115
Target Start/End: Original strand, 40738996 - 40739034
Alignment:
| Q |
77 |
ggttcatcttcctccctccctcatattctttatcatctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40738996 |
ggttcatcttcctccctccctcatattcttcatcatctt |
40739034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 219 - 256
Target Start/End: Original strand, 29466334 - 29466371
Alignment:
| Q |
219 |
cattatttcgatgcccatttatgaatttccatcttgga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29466334 |
cattatttcgatgcccatttatgaatttccatcttgga |
29466371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 77 - 115
Target Start/End: Original strand, 29466160 - 29466198
Alignment:
| Q |
77 |
ggttcatcttcctccctccctcatattctttatcatctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29466160 |
ggttcatcttcctccctccctcatattcttcatcatctt |
29466198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 219 - 256
Target Start/End: Complemental strand, 6242201 - 6242164
Alignment:
| Q |
219 |
cattatttcgatgcccatttatgaatttccatcttgga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6242201 |
cattatttcgatgcccatttatgaatttccatcttgga |
6242164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 77 - 115
Target Start/End: Complemental strand, 6242334 - 6242296
Alignment:
| Q |
77 |
ggttcatcttcctccctccctcatattctttatcatctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6242334 |
ggttcatcttcctccctccctcatattcttcatcatctt |
6242296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University