View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1509-Insertion-12 (Length: 203)

Name: NF1509-Insertion-12
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1509-Insertion-12
NF1509-Insertion-12
[»] chr7 (2 HSPs)
chr7 (8-77)||(6032733-6032802)
chr7 (140-203)||(6032871-6032934)
[»] chr6 (1 HSPs)
chr6 (140-176)||(6712976-6713012)


Alignment Details
Target: chr7 (Bit Score: 70; Significance: 9e-32; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 8 - 77
Target Start/End: Original strand, 6032733 - 6032802
Alignment:
8 aatctatcatcaggtaactagtgtttttctttatttgataattgtttcactgtttcaaaacataaaatta 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6032733 aatctatcatcaggtaactagtgtttttctttatttgataattgtttcactgtttcaaaacataaaatta 6032802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 140 - 203
Target Start/End: Original strand, 6032871 - 6032934
Alignment:
140 gggcttcaaatctttggaaaatcatgggaggattgcaataccagtccaaatcgatattagctga 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6032871 gggcttcaaatctttggaaaatcatgggaggattgcaataccagtccaaatcgatattagctga 6032934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 6712976 - 6713012
Alignment:
140 gggcttcaaatctttggaaaatcatgggaggattgca 176  Q
    ||||| |||||||||||||||||||||||||| ||||    
6712976 gggctccaaatctttggaaaatcatgggaggaatgca 6713012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University