View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509-Insertion-12 (Length: 203)
Name: NF1509-Insertion-12
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509-Insertion-12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 9e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 8 - 77
Target Start/End: Original strand, 6032733 - 6032802
Alignment:
| Q |
8 |
aatctatcatcaggtaactagtgtttttctttatttgataattgtttcactgtttcaaaacataaaatta |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032733 |
aatctatcatcaggtaactagtgtttttctttatttgataattgtttcactgtttcaaaacataaaatta |
6032802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 140 - 203
Target Start/End: Original strand, 6032871 - 6032934
Alignment:
| Q |
140 |
gggcttcaaatctttggaaaatcatgggaggattgcaataccagtccaaatcgatattagctga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032871 |
gggcttcaaatctttggaaaatcatgggaggattgcaataccagtccaaatcgatattagctga |
6032934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 6712976 - 6713012
Alignment:
| Q |
140 |
gggcttcaaatctttggaaaatcatgggaggattgca |
176 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
6712976 |
gggctccaaatctttggaaaatcatgggaggaatgca |
6713012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University