View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509-Insertion-13 (Length: 124)
Name: NF1509-Insertion-13
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509-Insertion-13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 7e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 7e-50
Query Start/End: Original strand, 4 - 103
Target Start/End: Original strand, 977835 - 977934
Alignment:
| Q |
4 |
aacacgatgctagtttcaatttttggcatatgtcaatatttcatttctctacggcaaaatgattatctagtaacaataaacaattaatggtgtcaacata |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
977835 |
aacacgatgctagtttcaatttttggcatatgtcaatatttcatttctctacggcaaaatgattatctagtaacaataaacaattaatggtgtcaacata |
977934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University