View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509-Insertion-19 (Length: 78)
Name: NF1509-Insertion-19
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509-Insertion-19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 7 - 71
Target Start/End: Original strand, 50373717 - 50373781
Alignment:
| Q |
7 |
accattcaccttcatctcttcttaatagtcctccctcccaccatgactttcgctgtctgaattaa |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50373717 |
accattcaccttcatctcttcttaatagtcctccctcccaccatgactttcgctgtctgaattaa |
50373781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University