View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15090_low_3 (Length: 338)
Name: NF15090_low_3
Description: NF15090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15090_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 120 - 321
Target Start/End: Complemental strand, 5680292 - 5680091
Alignment:
| Q |
120 |
cctgattattattggtgcatgacaccaatggaagaaggaggaggaggaggaagagacatgttgtggaaatgatgatgttcattgccataggtgtagacaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5680292 |
cctgattattattggtgcatgacaccaatggaagaaggagcaggaggaggaagagacatgttgtggaaatgatgatgttcattgccataggtgtagacaa |
5680193 |
T |
 |
| Q |
220 |
aacgcaatttgatataatgtgatgatatttataaagggttaaaggttaattacacgaatctctaaccaatgtttaccctcatctcaagaatatgtctctt |
319 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5680192 |
aacgcaatttgatgtaatgtgatgatatttataaagggttaaaggttaattacacgaatctctaaccaatgtttaccctcatctcaagaatatgtctctt |
5680093 |
T |
 |
| Q |
320 |
at |
321 |
Q |
| |
|
|| |
|
|
| T |
5680092 |
at |
5680091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 5680411 - 5680358
Alignment:
| Q |
1 |
gaaaatttcatcaaaagatgtttcacttgagactaagagttacaaataagagca |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5680411 |
gaaaatttcatcaaaagatgtttcacttgagactaagagttacaaataagagca |
5680358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 164
Target Start/End: Complemental strand, 5689642 - 5689598
Alignment:
| Q |
120 |
cctgattattattggtgcatgacaccaatggaagaaggaggagga |
164 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
5689642 |
cctgattatttttggtgcatgagaccaatggaagaaggagaagga |
5689598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University