View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15092_high_11 (Length: 239)
Name: NF15092_high_11
Description: NF15092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15092_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 10746491 - 10746699
Alignment:
| Q |
13 |
gagagtaagttagatatcatatgtacgtgttcctatgcagactgcgtcacttggggccaacaagtattgtgtctttcctagatgatttcactagaaagac |
112 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10746491 |
gagagtaagttagagatcatatgtacgtggtcctatgcagactgcatcacttggggccaacaagtattgtgtctttcctagatgatttcactagaaagac |
10746590 |
T |
 |
| Q |
113 |
attgatttacttgatcaagaagaaatgcgaagtgattgaagtattcaaactaaaaagaacatacgatggaggagaatatgactcggctgaatcaaggtgc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
10746591 |
attgatttacttgatcaagaagaaatgcgaagtgattgaagttttcaaactaaaaagaacatacggtggaggagaatatgtctcggctgaatcaaggtgc |
10746690 |
T |
 |
| Q |
213 |
tatgggaag |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
10746691 |
tatgggaag |
10746699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University