View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15092_high_5 (Length: 334)
Name: NF15092_high_5
Description: NF15092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15092_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 166 - 325
Target Start/End: Complemental strand, 21150127 - 21149964
Alignment:
| Q |
166 |
ttaaaatgtattgtatattgtgaaaaaatatgcatgtgaaatattacctatgtgcagagaattatgaaataaggtctattagactccattgctccttaaa |
265 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
21150127 |
ttaaaatgtattgtatattgggaaaaaatatgcatgtgaaatattacctatgtgcagagaattatgaaataaggtctattagactccattgctgctgaaa |
21150028 |
T |
 |
| Q |
266 |
tgaatgaaaatttaatgaaagagggacaat----gtttttggagagaaaaagaagtagtataat |
325 |
Q |
| |
|
|| |||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
21150027 |
tggatgaaaatttaatgaaggagggacaatgtttgttttgggagagaaaaagaagtagtataat |
21149964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University