View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15092_high_5 (Length: 334)

Name: NF15092_high_5
Description: NF15092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15092_high_5
NF15092_high_5
[»] chr5 (1 HSPs)
chr5 (166-325)||(21149964-21150127)


Alignment Details
Target: chr5 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 166 - 325
Target Start/End: Complemental strand, 21150127 - 21149964
Alignment:
166 ttaaaatgtattgtatattgtgaaaaaatatgcatgtgaaatattacctatgtgcagagaattatgaaataaggtctattagactccattgctccttaaa 265  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||    
21150127 ttaaaatgtattgtatattgggaaaaaatatgcatgtgaaatattacctatgtgcagagaattatgaaataaggtctattagactccattgctgctgaaa 21150028  T
266 tgaatgaaaatttaatgaaagagggacaat----gtttttggagagaaaaagaagtagtataat 325  Q
    || |||||||||||||||| ||||||||||    ||||| ||||||||||||||||||||||||    
21150027 tggatgaaaatttaatgaaggagggacaatgtttgttttgggagagaaaaagaagtagtataat 21149964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University