View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15092_low_15 (Length: 223)
Name: NF15092_low_15
Description: NF15092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15092_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 204
Target Start/End: Original strand, 5851830 - 5852016
Alignment:
| Q |
15 |
agagagatgtagaatggtaacatgaagtctttcatgcagtggtgattagccactcgttctatgaaaaagtatttgtcaagcaattcaactgcaccgcaca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5851830 |
agagagatgtagaatggtaacatgaagtctttcatgcagtggtgattagccactc---ctatgaaaaagtatgtgtcaagcaattcaactgcaccgcaca |
5851926 |
T |
|
| Q |
115 |
atgtctctttcatttacctattaagtcgattggttcttgcatcattttcgaagtgagggatgccaaccatgttcttaataccaactaaac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5851927 |
atgtctctttcatttacctattaagtcgattggttcttgcatcattttcgaagtgagggatgccaaccatgttcttaataccaactaaac |
5852016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University