View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15096_low_7 (Length: 278)
Name: NF15096_low_7
Description: NF15096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15096_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 7 - 266
Target Start/End: Complemental strand, 7266413 - 7266154
Alignment:
| Q |
7 |
taaaccctagccactcccaccaaaaatagccttaagctttttaacttgagcaggatcaagcaaagtactctttatcaaattagcagaactcaaattattt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7266413 |
taaaccctagccactcccaccaaaaatagccttaagctttttaacttgagcaggatcaagcaaagtgctctttatcaaattagcagaactcaaattattt |
7266314 |
T |
|
| Q |
107 |
ccaaacaaagcaagatcaagaacttgtgaaccagggttttcactactaaaagtaagataagcagaagctttattccttccagcattatattgaaaatgca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7266313 |
ccaaacaaagcaagatcaagaacttgtgaaccagggttttcactactaaaagtaagataagcagaagctttattccttccagcattatattgaaaatgca |
7266214 |
T |
|
| Q |
207 |
acaaaccttgtggaagaaccaaaatttgaccttttgaaagtgtcttgataaaaacagtat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7266213 |
acaaaccttgtggaagaaccaaaatttgaccttttgaaagtgtcttgataaaaacagtat |
7266154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 109 - 227
Target Start/End: Complemental strand, 7287411 - 7287293
Alignment:
| Q |
109 |
aaacaaagcaagatcaagaacttgtgaaccagggttttcactactaaaagtaagataagcagaagctttattcctt-ccagcattatattgaaaatgcaa |
207 |
Q |
| |
|
||||||| ||||||||| | ||| | |||||| ||| ||||||||||||||||| |||||| |||||| | |||| |||| |||| |||||||||||| |
|
|
| T |
7287411 |
aaacaaaagaagatcaagtaattgagcaccaggatttgcactactaaaagtaagaaaagcagtagcttt-tcccttaccagaattaacttgaaaatgcaa |
7287313 |
T |
|
| Q |
208 |
caaaccttgtggaagaacca |
227 |
Q |
| |
|
|| ||||| |||| ||||| |
|
|
| T |
7287312 |
catcccttggggaaaaacca |
7287293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University