View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15097_high_12 (Length: 249)
Name: NF15097_high_12
Description: NF15097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15097_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 37696881 - 37697119
Alignment:
| Q |
1 |
tcggtcgtgtcacttggtgataaccctactgatcctactcattgggtttatggagtggcattgaaatatacacatggtgtttttgatgacattgtgacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37696881 |
tcggtcgtgtcacttggtgataaccctactgatcctactcattgggtttatggagtggcattgaaatatacacatggtgtttttgatgacattgtgacca |
37696980 |
T |
 |
| Q |
101 |
ctgagtgtactagttgtgagagtagtggtggtgtgtgtggatatgctcctccaggaagtggatttgtttgtgtttgtaaaagtggatataatactagcct |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37696981 |
ctaagtgtactagttgtgagagtagtggtggtgtgtgtggatatgctcctccaggaagtggatttgtttgtgtttgtaaaagtggatataatactagcct |
37697080 |
T |
 |
| Q |
201 |
tgattgctctaattacgatcaaaaccaggatttcctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37697081 |
tgattgctctaattacgatcaaaaccaggatttcctttg |
37697119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University