View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15097_high_8 (Length: 310)
Name: NF15097_high_8
Description: NF15097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15097_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 11 - 291
Target Start/End: Original strand, 34241827 - 34242106
Alignment:
| Q |
11 |
cagagacaccaaacatttaacatcagacaagctgcataaatgcgtaaattagcaagtgttatacttaggataaggcacagaaattttccacctgcacctc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34241827 |
cagagacaccaaacatttaacatcagacaagctgcataaatgcgtaaattagcaagtgt-atacttaggataaggcacagaaattttccacctgcacctc |
34241925 |
T |
|
| Q |
111 |
aacctggggacataactataagaaagcaataaattacctgctttagactggaaacagcacattcttcaatttccttcagcccatcctgttcactttcgta |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34241926 |
aacctggggacatacctataagaaagcaataaattacctgctttagactggaaacagcacattcttcaatttccttcagcccatcctgttcactttcgta |
34242025 |
T |
|
| Q |
211 |
tgctgctgatatctcatgctgagccttgtggaccattgcaagcccggcccatgctattggaagctcaaccagggatgaatc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34242026 |
tgctgctgatatctcatgctgagccttgtggaccattgcaagcccggcccatgctattggaagctcaaccagggatgaatc |
34242106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University