View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509R-Insertion-10 (Length: 400)
Name: NF1509R-Insertion-10
Description: NF1509R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509R-Insertion-10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 9 - 308
Target Start/End: Complemental strand, 52170243 - 52169943
Alignment:
| Q |
9 |
ccctgtctctaggctgacccgctgattttgtttgtatacacacatatttcacttgcacatgcattccttgctatttgcttt-aagtggagtgcatattga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
52170243 |
ccctgtctctaggctgacccgctgattttgtttgtatacacacatatttcacttgcacatgcattccttgctatttgcttttaagtgcagtgcatattga |
52170144 |
T |
|
| Q |
108 |
acttgacactatcatgcatcacttgagtagacacgtatattgatctggtgaccgcacctgacttcattccagatggcacgtccatgtaactgttgaagtg |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52170143 |
acttgacactatcatgcatcatttgagtagacacgtatattgatctggtgaccgcacctgacttcattccagatggcacgtccatgtaacggttgaagtg |
52170044 |
T |
|
| Q |
208 |
gatccattggaattaatggaattggattagattcgattagatgtaatcacaaccacatgaagtcaggtgcggtcaccggatcagaatcattagattatga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
52170043 |
gatccattggaattaatggaattggattagattcgattagatgtaatcacaaccacatgaagtcaggtacggtcaccagatcagaatcattagattatga |
52169944 |
T |
|
| Q |
308 |
t |
308 |
Q |
| |
|
| |
|
|
| T |
52169943 |
t |
52169943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 306 - 400
Target Start/End: Complemental strand, 52169915 - 52169821
Alignment:
| Q |
306 |
gatttacgtttagtataaaattttgatgttaaattatggatggtctgatcaagatcagatacttctactagctttcttactgtacgccatcactg |
400 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||| |
|
|
| T |
52169915 |
gatttacgtttagtataaaattctgatgttaaattatggatggtctgatcaagatcagacagttctactagctttcttactttacgccatcactg |
52169821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University