View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509R-Insertion-14 (Length: 332)
Name: NF1509R-Insertion-14
Description: NF1509R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509R-Insertion-14 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 9 - 332
Target Start/End: Complemental strand, 6032737 - 6032414
Alignment:
| Q |
9 |
agattcattcttgatattgcagaaaagttggatcttccagtggcagcatcattgttattattattagcatcccaatttggtgataacattggagagtcat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032737 |
agattcattcttgatattgcagaaaagttggatcttccagtggcagcatcattgttattattattagcatcccaatttggtgataacattggagagtcat |
6032638 |
T |
|
| Q |
109 |
gatcaaaactagcttccttagggatcaaattagtgttttgttgataatgatgagaagaagatttcttcaactttctcttaatcacaatagattcctcaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032637 |
gatcaaaactagcttccttagggatcaaattagtgttttgttgataatgatgagaagaagatttcttcaactttctcttaatcacaatagattcctcaat |
6032538 |
T |
|
| Q |
209 |
gaagttaaagatatcatctctttgaagtgattttgaagtttcatcttcattaggcatcaattgatgaaggatttgttgattttgatcaatttcaggatat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032537 |
gaagttaaagatatcatctctttgaagtgattttgaagtttcatcttcattaggcatcaattgatgaaggatttgttgattttgatcaatttcaggatat |
6032438 |
T |
|
| Q |
309 |
ttttctttcaaatcttcttgcatc |
332 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6032437 |
ttttctttcaaatcttcttgcatc |
6032414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University