View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509R-Insertion-16 (Length: 317)
Name: NF1509R-Insertion-16
Description: NF1509R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509R-Insertion-16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 9 - 229
Target Start/End: Complemental strand, 40360090 - 40359870
Alignment:
| Q |
9 |
gctaccacccaatatcttcctgtacaggtgaacacagaagccgtcttgttgctgcgaaagcagcaaattgatcatatactatatgatattattacttgct |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40360090 |
gctaccacccaatatcttcctgtacaggtgaacacagaagccgtcttgttgctgcaaaagcagcaaattgatcata--ctatatgatattattacttgct |
40359993 |
T |
|
| Q |
109 |
acgtactaggtattagaagaatgaagcagcttgtaataatttcatttttctccctc--nnnnnnnnnnctattactttttagccatttttggcttgttta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40359992 |
acgtactaggtattagaagaatgaagcagcttgtaataatttcatttttctccctcttttttttttttctattactttttagccatttttggcttgttta |
40359893 |
T |
|
| Q |
207 |
atcgattcaattccttatgaatc |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40359892 |
atcgattcaattccttatgaatc |
40359870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 246 - 310
Target Start/End: Complemental strand, 40359876 - 40359812
Alignment:
| Q |
246 |
atgaatcagaagaattagaccacaacacatggttgtctctgttcattatgtgaaatgcctagtac |
310 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40359876 |
atgaatcagaagaatcagaccacaacacatggttgtctttgttcattatgtgaaatgcctagtac |
40359812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University