View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509R-Insertion-19 (Length: 218)
Name: NF1509R-Insertion-19
Description: NF1509R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509R-Insertion-19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 9 - 202
Target Start/End: Original strand, 4546694 - 4546883
Alignment:
| Q |
9 |
cttccaacaccaatccactcaaagaaacttcaatttacaaacaaaacaagagagcagcggttcttatttgtttattcgaaggtcaagatgggaatttgcg |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4546694 |
cttccaacaccaatccactaaaagaaacttcaatttacaaacaaaacaagagagcagcggttcttatttgtttattcgaaggtcaagatgggaatttgcg |
4546793 |
T |
|
| Q |
109 |
tgttattcttacacaacgtgcttcttctctctcaacccacgccggttagtttcgtctcgtgtctgacatgtgtgatgtgattactttcaattaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
4546794 |
tgttattcttacacaacgtgcttcttctctctcaacccacgccggttagtttagtttcgtgtctgacatgtgtgat----ttactttcaattaa |
4546883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University