View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_high_29 (Length: 241)
Name: NF1509_high_29
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_high_29 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 22 - 241
Target Start/End: Original strand, 42800458 - 42800677
Alignment:
| Q |
22 |
gaactctatccgccgccatagcacggtgagcctcttcagaaaacatcacattccgagaagaagaaccaccctcttcttgagaagcagcagctcgaaaccg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800458 |
gaactctatccgccgccatagcacggtgagcctcttcagaaaacatcacattccgagaagaagaaccaccctcttcttgagaagcagcagctcgaaaccg |
42800557 |
T |
|
| Q |
122 |
ttgccacgtacgaggaatcatgatcacgtgatcagctctgaagtgaagaatcagcacgaaggaaaacttgtttcaaaccaatttatagtgttattactta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800558 |
ttgccacgtacgaggaatcatgatcacgtgatcagctctgaagtgaagaatcagcacgaaggaaaacttgtttcaaaccaatttatagtgttattactta |
42800657 |
T |
|
| Q |
222 |
cacttcttcttcttctagat |
241 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42800658 |
cacttcttcttcttctagat |
42800677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 193 times since January 2019
Visitors: 8795