View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_high_31 (Length: 239)
Name: NF1509_high_31
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 88 - 220
Target Start/End: Original strand, 37154217 - 37154349
Alignment:
| Q |
88 |
ttatatattgataagaattgattgcttgagatgtagatggtacaactagaagctctgttaaaagagttggtcagagcctcagataaaagatagtttaata |
187 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37154217 |
ttatatattgataataattgattgcttgagatgtagatggtacaactagaagctctgttaaaagagttggtcagagcctcagataaaagatagtttaata |
37154316 |
T |
 |
| Q |
188 |
attagaagtagaggattatttggaaagaactac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37154317 |
attagaagtagaggattatttggaaagaactac |
37154349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 95
Target Start/End: Original strand, 37154182 - 37154214
Alignment:
| Q |
63 |
ttttgttatataatcattatatgtgttatatat |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37154182 |
ttttgttatataatcattatatgtgttatatat |
37154214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 37154152 - 37154181
Alignment:
| Q |
1 |
ttttacaaagccggtaattgaactttatca |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37154152 |
ttttacaaagccggtaattgaactttatca |
37154181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University