View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_high_32 (Length: 238)
Name: NF1509_high_32
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 144 - 202
Target Start/End: Complemental strand, 3239126 - 3239068
Alignment:
| Q |
144 |
agccatcgaagttattattgggttgagtcattttggtggttataacttcggtcgctgga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
3239126 |
agccatcgaagttattattgggttgagttgttttggtgtttataacttcggtcgctgga |
3239068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 17 - 67
Target Start/End: Complemental strand, 3239248 - 3239198
Alignment:
| Q |
17 |
aagtatgaaaacatttattaaagcaaaactttattttgaatcagatggagc |
67 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3239248 |
aagtataaaaacatttattaaagcaaaactttattttgaatcagatggagc |
3239198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University