View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1509_high_33 (Length: 237)

Name: NF1509_high_33
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1509_high_33
NF1509_high_33
[»] chr7 (1 HSPs)
chr7 (18-227)||(35485400-35485615)


Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 35485615 - 35485400
Alignment:
18 actctgaacactcacttcgctttttctgcaatttggttttgcactcatacatgagtctgtgagattgtcttggataatgtttgtttaggttttgcttaat 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
35485615 actctgaacactcacttcgctttttctgcaatttggttttgcactcatacatgagtctgtgagattgtcttggataatgtttgtttaggttttgtttaat 35485516  T
118 actcgtttaaggttgttgttactcttttttgtttcactcttgtg------ttgacaagttatatatcacctgttatggtttgattgtgtggttataccgt 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||      |||| |||||||||||||||||||||||||||||||||||||||||||||    
35485515 actcgtttaaggttgttgttactcttttttgtttcactcttgtgttgaacttgaaaagttatatatcacctgttatggtttgattgtgtggttataccgt 35485416  T
212 gtcaggtcctttgctt 227  Q
    ||||||||||||||||    
35485415 gtcaggtcctttgctt 35485400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University