View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_high_34 (Length: 236)
Name: NF1509_high_34
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_high_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 9072961 - 9072745
Alignment:
| Q |
1 |
attcccattttccactaattaattatcactaattgtcattgtttccattacacaattccccaaactccatcctcattatttctgaatatttctcattgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072961 |
attcccattttccactaattaattatcactaattgtcattgtttccattactcaattccccaaactccatcctcattatttctgaatatttctcattgtg |
9072862 |
T |
|
| Q |
101 |
actattcttcttctttttgtagaagtattgatgaatnnnnnnnnntgcaatgcatggtttttgttttgctttcattcactttattcaatgtctcttttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9072861 |
actattcttcttctttttgtagaagtattgatcaat---aaaaaatgcaatgcatggtttttgttttgctttcattcactttattcaatgcctcttttat |
9072765 |
T |
|
| Q |
201 |
gtgagtttttcattcatgta |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
9072764 |
gtgagtttttcattcatgta |
9072745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University