View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_high_6 (Length: 436)
Name: NF1509_high_6
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 2e-56; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 9 - 176
Target Start/End: Complemental strand, 2914493 - 2914322
Alignment:
| Q |
9 |
gagatgaagttgtttagttgagcgttatttgggattgagat-ttttggaagaaaat--tataacttgtaaatttaccaagtgtgattggacggtttgatt |
105 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2914493 |
gagatgaagttgtttaggtgagtgttatttgggattgagatcttttggaagaaaatattataacttgtaaatttaccaagtgtgattggacggtttgatt |
2914394 |
T |
|
| Q |
106 |
tcatcttaattttgttgttttnnnnnnntcgcgcttgattgtttctaaattctaatatt-cggattttatat |
176 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2914393 |
tcatcttaattttgttgttttaaaaaaatcgcgcttgattgtttctaaattctaatattggggattttatat |
2914322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 168 - 251
Target Start/End: Complemental strand, 2914137 - 2914054
Alignment:
| Q |
168 |
attttatatttatgcgacaattttgggattaagtttgctgaattttcggtaattttgttccagtacatgtgtgataactgatag |
251 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2914137 |
attttatatttatgcgacaattttaggattaagtttgctgaattttcggtagttttgttccagtacatgtgtgataactgatag |
2914054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 347 - 418
Target Start/End: Complemental strand, 2913962 - 2913891
Alignment:
| Q |
347 |
ctaaagatagtcaaatatacttaataattggatagtcaaaagagaatcaccctcaaaaattacaaagtcaat |
418 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2913962 |
ctaaggatagtcaaatatacttaataattagatagtcaaaagagaatcaccctcaaaaattacaaagtcaat |
2913891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16742 times since January 2019
Visitors: 1282