View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_low_12 (Length: 346)
Name: NF1509_low_12
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 17 - 335
Target Start/End: Complemental strand, 34885545 - 34885227
Alignment:
| Q |
17 |
caacatcgtcggcattaaacactactccggcaccatcaccggtcgcgaaatcctcggcttaatccgcgaacctttaaacccatacgattccaacgccatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34885545 |
caacatcgtcggcattaaacactactccggcaccatcaccggtcgcgaaatcctcggcttaatccgcgaacctttaaacccatacgattccaacgccatc |
34885446 |
T |
 |
| Q |
117 |
aaagtcctcaacactcaaacgctccaagtcggttacatcgaacgctccgtcgcctccgctctcgctcctctcctcgacgctcacatcatccacgtcgaag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34885445 |
aaagtcctcaacactcaaacgctccaagtcggttacatcgaacgcgccgttgcctccgctctcgctcctctcctcgacgctcacatcatccacgtcgaag |
34885346 |
T |
 |
| Q |
217 |
ccatcgttcaaccccgctctaacaataacaaattccgtatcccttgtcagattcatatcttcgctcatcaatcttcttttgatgctgttcatgacgcttt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34885345 |
ccatcgttcaaccccgctctaacaataacaaattccgtatcccttgtcagattcatatcttcgctcatcaatcttcttttgatgctgttcatgacgcttt |
34885246 |
T |
 |
| Q |
317 |
taacggttccaatgttcat |
335 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34885245 |
taacggttccaatgttcat |
34885227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University