View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_low_13 (Length: 339)
Name: NF1509_low_13
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 40360090 - 40359870
Alignment:
| Q |
18 |
gctaccacccaatatcttcctgtacaggtgaacacagaagccgtcttgttgctgcaaaagcagcaaattgatcatatactatatgatattattacttgct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40360090 |
gctaccacccaatatcttcctgtacaggtgaacacagaagccgtcttgttgctgcaaaagcagcaaattgatcata--ctatatgatattattacttgct |
40359993 |
T |
|
| Q |
118 |
acgtactaggtattagaagaatgaagcagcttgtaataatttcatttttctccctc--nnnnnnnnnnctattactttttagccatttttggcttgttta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40359992 |
acgtactaggtattagaagaatgaagcagcttgtaataatttcatttttctccctcttttttttttttctattactttttagccatttttggcttgttta |
40359893 |
T |
|
| Q |
216 |
atcgattcaattccttatgaatc |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40359892 |
atcgattcaattccttatgaatc |
40359870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 255 - 332
Target Start/End: Complemental strand, 40359876 - 40359798
Alignment:
| Q |
255 |
atgaatcagaagaattagaccacaacacatggttgtctttgttcattatgtgaaatgcctagtac-acatttttctctg |
332 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40359876 |
atgaatcagaagaatcagaccacaacacatggttgtctttgttcattatgtgaaatgcctagtactacatttttctctg |
40359798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University