View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_low_21 (Length: 306)
Name: NF1509_low_21
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 66 - 301
Target Start/End: Original strand, 34887931 - 34888166
Alignment:
| Q |
66 |
tttgttgctgttgattgcacttgttggtcaatgaaggctcatgttcctcatcctataaaagaaagtaaagagtattaatcaaacagtagatttatgaaaa |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34887931 |
tttgttgctgttgattgcacttgttggtcaatgaaggctcatgttcctcatcctataaaagaaagtaaagagtattaatcaaacagtagatttatgaaaa |
34888030 |
T |
|
| Q |
166 |
tcagataatnnnnnnnnnngttgattagagttatagtagttatatttaactattgcttcataagcttctgtttaattatttaacaagcaacatgtaggga |
265 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34888031 |
tcagataataaaaaaaaaagttgattagagttatagtagttatatttaacttttgcttcataagcttctgtttaattatttaacaagcaacatgtaggga |
34888130 |
T |
|
| Q |
266 |
atatgaagctatttatttaattatgataccttttct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34888131 |
atatgaagctatttatttaattatgataccttttct |
34888166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 6 - 41
Target Start/End: Original strand, 34887870 - 34887905
Alignment:
| Q |
6 |
acacccctcaataccattaattaggatacttcaaac |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34887870 |
acacccctcaataccattaattaggatacttcaaac |
34887905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University