View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_low_27 (Length: 259)
Name: NF1509_low_27
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 44027616 - 44027845
Alignment:
| Q |
18 |
ttgacatatcaataatatagacctaactgttaatgtagataagttcattgtgatgtgtatatgaaaccataaagagggaaacagtgtataaagtagttct |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44027616 |
ttgatatatcaataatatagacctaactgttaatgtagataagttcattgtgatgtgtatatgaaaccataaagagggaaacagtgtataaagtagttct |
44027715 |
T |
 |
| Q |
118 |
taaaaccaataacatgtaactagacataggtttggtttagaggatgtcacagtttatgcattaatgggaggcattggtaccccatctacattcccacttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44027716 |
taaaaccaataacatgtaactagacataggtttggtttagaggatgtcacagtttatgcattaatgggaggcattggtaccccatctacattcccacttt |
44027815 |
T |
 |
| Q |
218 |
gaagattcaccattagaatttctacatctg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44027816 |
gaagattcaccattagaatttctacatctg |
44027845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University