View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_low_32 (Length: 248)
Name: NF1509_low_32
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 39 - 232
Target Start/End: Complemental strand, 4546883 - 4546694
Alignment:
| Q |
39 |
ttaattgaaagtaatcacatcacacatgtcagacacgagacgaaactaaccggcgtgggttgagagagaagaagcacgttgtgtaagaataacacgcaaa |
138 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4546883 |
ttaattgaaagtaa----atcacacatgtcagacacgaaactaaactaaccggcgtgggttgagagagaagaagcacgttgtgtaagaataacacgcaaa |
4546788 |
T |
 |
| Q |
139 |
ttcccatcttgaccttcgaataaacaaataagaaccgctgctctcttgttttgtttgtaaattgaagtttctttgagtggattggtgttggaag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4546787 |
ttcccatcttgaccttcgaataaacaaataagaaccgctgctctcttgttttgtttgtaaattgaagtttcttttagtggattggtgttggaag |
4546694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University