View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_low_36 (Length: 241)
Name: NF1509_low_36
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1509_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 52764401 - 52764180
Alignment:
| Q |
1 |
atcttgaaggcttaaaatcagaagtgtcttatttgttgtctttttgagataaaaacaatttttgtgaaagtgactagtgatgaatgtggatcattagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52764401 |
atcttgaaggcttaaaatcagaagtgtcttatttgttgtctttttgagataaaa-caatttttgtgaaagtgactagtgatgaatgtggatcattagaga |
52764303 |
T |
|
| Q |
101 |
ttcaaaattgtattttccattgtcatactgctaatgctgggtaaatatatgacaatgaaacacaatgcagaacaggactaatcaattatcataagggtac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52764302 |
ttcaaaattgtattttccattgtcatactgctaatgctgggtaaatatatgacaatgaaacacaatgcagaacaggactaatcaattatcataagggtac |
52764203 |
T |
|
| Q |
201 |
aattttaattttagttatatacg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52764202 |
aattttaattttagttatatacg |
52764180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 4 - 103
Target Start/End: Complemental strand, 52770371 - 52770273
Alignment:
| Q |
4 |
ttgaaggcttaaaatcagaagtgtcttatttgttgtctttttgagataaaaacaatttttgtgaaagtgactagtgatgaatgtggatcattagagattc |
103 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||| ||| ||||||||| ||||||||| | | ||||| ||||||||||||||||||||| |
|
|
| T |
52770371 |
ttgaaggcttaaaatcaatagtgtcttattttttgtctttttgggat-aaaacaattcttgtgaaagcggttggtgataaatgtggatcattagagattc |
52770273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University