View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_low_39 (Length: 237)
Name: NF1509_low_39
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1509_low_39 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 35485615 - 35485400
Alignment:
Q |
18 |
actctgaacactcacttcgctttttctgcaatttggttttgcactcatacatgagtctgtgagattgtcttggataatgtttgtttaggttttgcttaat |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
35485615 |
actctgaacactcacttcgctttttctgcaatttggttttgcactcatacatgagtctgtgagattgtcttggataatgtttgtttaggttttgtttaat |
35485516 |
T |
|
Q |
118 |
actcgtttaaggttgttgttactcttttttgtttcactcttgtg------ttgacaagttatatatcacctgttatggtttgattgtgtggttataccgt |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35485515 |
actcgtttaaggttgttgttactcttttttgtttcactcttgtgttgaacttgaaaagttatatatcacctgttatggtttgattgtgtggttataccgt |
35485416 |
T |
|
Q |
212 |
gtcaggtcctttgctt |
227 |
Q |
|
|
|||||||||||||||| |
|
|
T |
35485415 |
gtcaggtcctttgctt |
35485400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4074 times since January 2019
Visitors: 1269