View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1509_low_43 (Length: 223)
Name: NF1509_low_43
Description: NF1509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1509_low_43 |
![](./plan/images/spacer.gif) | ![NF1509_low_43](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 14426919 - 14426727
Alignment:
Q |
17 |
attgagcaaattttatggcaccgatttatgactttttaagaatcattttcaggttatagtgggtagttttactttggatggcaaaaattgtagctcaagt |
116 |
Q |
|
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14426919 |
attgagcaaattttgtgggaccgatttatgactttttaagaatcattttcaggttatagtgggtagttttactttggatggcaaaaattgtagctcaagt |
14426820 |
T |
![](./plan/images/spacer.gif) |
Q |
117 |
aacctgaaattggggccttcttcaatgacaatatctcaatttgctgctcctgggactccaactagtgctgctgcctctcaagggccttcatct |
209 |
Q |
|
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14426819 |
aacctgaaattggggtcttcttcaatgacgatatctcaatttgctgctcctaggactccaactagtgctgctgcctctcaagggccttcatct |
14426727 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 41 - 185
Target Start/End: Complemental strand, 14416841 - 14416697
Alignment:
Q |
41 |
tttatgactttttaagaatcattttcaggttatagtgggtagttttactttggatggcaaaaattgtagctcaagtaacctgaaattggggccttcttca |
140 |
Q |
|
|
|||||||||||||||||||||||||||||| | ||||| | ||||||||||||||| ||||||| ||||||| ||||||||||| ||||||||||||||| |
|
|
T |
14416841 |
tttatgactttttaagaatcattttcaggtcaaagtggcttgttttactttggatgacaaaaatggtagctcgagtaacctgaatttggggccttcttca |
14416742 |
T |
![](./plan/images/spacer.gif) |
Q |
141 |
atgacaatatctcaatttgctgctcctgggactccaactagtgct |
185 |
Q |
|
|
|| ||||||| |||||||||||| ||||||||||||||||||| |
|
|
T |
14416741 |
ataccaatatcccaatttgctgcttttgggactccaactagtgct |
14416697 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 50 - 103
Target Start/End: Original strand, 4867398 - 4867451
Alignment:
Q |
50 |
ttttaagaatcattttcaggttatagtgggtagttttactttggatggcaaaaa |
103 |
Q |
|
|
||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
T |
4867398 |
ttttaagaatcatttccaggtcatagtgggtagttttacattggatggcaaaaa |
4867451 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 177
Target Start/End: Complemental strand, 3409833 - 3409698
Alignment:
Q |
42 |
ttatgactttttaagaatcattttcaggttatagtgggtagttttactttggatggcaaaaattgtagctcaagtaacctgaaattggggccttcttcaa |
141 |
Q |
|
|
||||||||| |||| |||||||| ||||| | |||||||||||||||||||||| || || |||||| | |||| ||||| | |||||||||||| |
|
|
T |
3409833 |
ttatgacttattaaaaatcatttacaggtcactgtgggtagttttactttggatgttaagaaggctagctcgaataacttgaaaattgggccttcttcag |
3409734 |
T |
![](./plan/images/spacer.gif) |
Q |
142 |
tgacaatatctcaatttgctgctcctgggactccaa |
177 |
Q |
|
|
|| || || ||| |||||||| |||||||||||| |
|
|
T |
3409733 |
tgccatcgtcccaaattgctgcttctgggactccaa |
3409698 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 104
Target Start/End: Original strand, 7159253 - 7159307
Alignment:
Q |
50 |
ttttaagaatcattttcaggttatagtgggtagttttactttggatggcaaaaat |
104 |
Q |
|
|
||||| ||||||||| ||||| |||||||| || |||||||||||||| |||||| |
|
|
T |
7159253 |
ttttatgaatcatttacaggtcatagtgggcagctttactttggatggaaaaaat |
7159307 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15486 times since January 2019
Visitors: 1260