View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15101_low_22 (Length: 201)
Name: NF15101_low_22
Description: NF15101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15101_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 26 - 87
Target Start/End: Complemental strand, 10647538 - 10647477
Alignment:
| Q |
26 |
caaatgctggtgcaagcacaaaaattcgaatcgtgtgaacattgcaaaatcaaaataatgtt |
87 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10647538 |
caaatgttggtttaagcacaaaaattcgaatcgtgtgaacattacaaaatcaaaataatgtt |
10647477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 10647444 - 10647377
Alignment:
| Q |
88 |
ataagttgcgaacttaacaaaa-gtacacttaagaactagaagaaatcttcaaaagtcatttttaata |
154 |
Q |
| |
|
|||||||| ||||||||||||| ||| |||||| || ||||||| ||||| | ||||||||||||||| |
|
|
| T |
10647444 |
ataagttgtgaacttaacaaaaagtatacttaaaaattagaagagatctttagaagtcatttttaata |
10647377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 138 - 190
Target Start/End: Complemental strand, 10647356 - 10647303
Alignment:
| Q |
138 |
aaaagtcatttttaataa-tgaaaagtatatattcgttcaattgatattcttcg |
190 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||| ||||||||||||| |||| |
|
|
| T |
10647356 |
aaaagtcagttttaataaattaaaagtatatattcattcaattgatattattcg |
10647303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University