View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15102_high_5 (Length: 299)
Name: NF15102_high_5
Description: NF15102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15102_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 136 - 284
Target Start/End: Complemental strand, 17371926 - 17371778
Alignment:
| Q |
136 |
gcatatgtgtatccgtgggttggagaaagtgggtattgattaatttactcttaatctcgattatcaatgcatattagtctttttggtgtattggaatagt |
235 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17371926 |
gcatatatgtatccgtgggttgaagaaagtgggtattgattaatttactcttaatctcgattatcaatgcatattagactttttggtgtattggaatagt |
17371827 |
T |
|
| Q |
236 |
agctctctggtctaggctacagccttgtgtgtcgcttaagcctccttac |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17371826 |
agctctctggtctaggctacagccttgtgtgtcgcttaagcctccttac |
17371778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 64 - 125
Target Start/End: Complemental strand, 17371981 - 17371916
Alignment:
| Q |
64 |
aggaatcaagttttgtatcaata----atgctagtcaagagttatctgtattggtgcatatatgta |
125 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17371981 |
aggaatcaagttttgtatcaatattcaatgctagtcaagagttatctgtattggtgcatatatgta |
17371916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University