View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15105_low_13 (Length: 378)
Name: NF15105_low_13
Description: NF15105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15105_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 75 - 361
Target Start/End: Original strand, 43588540 - 43588837
Alignment:
| Q |
75 |
tactatagtattactagtagaaacgttccaaagtctgaagaaactactctgg-----------tagaaacgttcctcgtcctcaatttcactactacaaa |
163 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43588540 |
tactatggtattactagtagaaacgttccaaagtctgaaggaactactctggtattatgctggtagaaacgttcctcgtcctcaatttcactactataaa |
43588639 |
T |
 |
| Q |
164 |
attcaagttctgatgggtgttgatgggtcactttacagtgattcctcgtgttcaaaatttgtgctcaatttcacagtgattcttcgtacggccacctcca |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
43588640 |
attcaagttctgatgggtgttgatgggtcactttacagtgattcctcgtgttcaaaatttgtgctcaatttcacagtgattcttcgtacgaccatctcca |
43588739 |
T |
 |
| Q |
264 |
cggtttaatatgtcatagcttgaagaccatatgcaataataccaaattgatctccagttgaaagggacagaacgatgtcatcggataaaggtcgtcgg |
361 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43588740 |
cggttaaatctgtcatagcttgaagaccatatgcaagaataccaaattgatctccagttgaaagggacagaacgatgtcatcggataaaggtcgtcgg |
43588837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University