View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15105_low_22 (Length: 246)

Name: NF15105_low_22
Description: NF15105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15105_low_22
NF15105_low_22
[»] chr1 (2 HSPs)
chr1 (162-237)||(43618845-43618919)
chr1 (13-58)||(43618965-43619010)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 237
Target Start/End: Complemental strand, 43618919 - 43618845
Alignment:
162 tactttcccttttaagaaatttgcaactggaaattacattcatgtattttatgttttcgtgcattttttaacattc 237  Q
    ||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||  ||||| ||||||||||||    
43618919 tactttcccttttaagaaatttgcaactgaaaattacatt-gtgtattttatgtttgtgtgcagtttttaacattc 43618845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 43619010 - 43618965
Alignment:
13 acatgaatgaaataaagttattcttttgataaatccttgatatttt 58  Q
    |||||||||||||||||||||||||||||||||| | |||||||||    
43619010 acatgaatgaaataaagttattcttttgataaatacatgatatttt 43618965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University