View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15105_low_22 (Length: 246)
Name: NF15105_low_22
Description: NF15105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15105_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 237
Target Start/End: Complemental strand, 43618919 - 43618845
Alignment:
| Q |
162 |
tactttcccttttaagaaatttgcaactggaaattacattcatgtattttatgttttcgtgcattttttaacattc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||| |||||||||||| |
|
|
| T |
43618919 |
tactttcccttttaagaaatttgcaactgaaaattacatt-gtgtattttatgtttgtgtgcagtttttaacattc |
43618845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 43619010 - 43618965
Alignment:
| Q |
13 |
acatgaatgaaataaagttattcttttgataaatccttgatatttt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
43619010 |
acatgaatgaaataaagttattcttttgataaatacatgatatttt |
43618965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University