View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15105_low_23 (Length: 237)
Name: NF15105_low_23
Description: NF15105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15105_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2640038 - 2639812
Alignment:
| Q |
1 |
tcaacatacaagcatatcattgtgatatcagtgtcactcaggtttaacacatacataccatatttaattgtgcatattttgaagccaagatgaatnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2640038 |
tcaacatacaagcatatcattgtgatatcagtgtccctcaggtttaacacatacataccatatttaattgtgcatattttgaagccaagatgaataaaaa |
2639939 |
T |
 |
| Q |
101 |
nnnn-ctgatttatcctcttgttccatgctcttgaagcctcctttaaaccatctagtgcctcatgcaaattatacaccatatg----ttcgtttttacct |
195 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
2639938 |
aaaaactgatctatcctcttgttccatgctcttgaagcctcctttaaaccatctagtgcctcatgcaaattatacaccatatgttacttcgcttttacct |
2639839 |
T |
 |
| Q |
196 |
caaatcctgaaagttgagtgacaaaaa |
222 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
2639838 |
caaatcctgaaggttgagtgacaaaaa |
2639812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University