View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15105_low_25 (Length: 215)
Name: NF15105_low_25
Description: NF15105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15105_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 38 - 203
Target Start/End: Complemental strand, 26042619 - 26042452
Alignment:
| Q |
38 |
tttttctcatcttcagacacaccctagtgtggcatctcatctcacataccctgtaatctcggaccttactgcc-tttttgtcttcatccaaattgttgtc |
136 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
26042619 |
tttttctcatcttcaaacacaccctagtgtggcatctcatctcacataccctataatcgtggaccttactgccctttttgtcttcagtcaaattgctgtc |
26042520 |
T |
 |
| Q |
137 |
ctaatgactcaaactctatatcatatcatccaagccactttccaacactaaagtgct-cctttgctac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26042519 |
ctaatgactcaaactctatatcatatcatccaagccactttccaacactaaagtgctccctttgctac |
26042452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University