View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15106_high_12 (Length: 221)

Name: NF15106_high_12
Description: NF15106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15106_high_12
NF15106_high_12
[»] chr2 (1 HSPs)
chr2 (27-131)||(15350387-15350491)


Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 27 - 131
Target Start/End: Complemental strand, 15350491 - 15350387
Alignment:
27 gtttatgtttatgtttatgaaccctagtnnnnnnnnntacaagacctctctattattctggctatttatagaagagaggagcgttgggttgtatatagag 126  Q
    ||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||    
15350491 gtttatgtttatgtttatgaaccctagtaaaaaaaaatacaagacctctctattattctggctatttatagaagagaggagtgttgggttgtataaagag 15350392  T
127 agaga 131  Q
    |||||    
15350391 agaga 15350387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University