View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15106_high_12 (Length: 221)
Name: NF15106_high_12
Description: NF15106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15106_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 27 - 131
Target Start/End: Complemental strand, 15350491 - 15350387
Alignment:
| Q |
27 |
gtttatgtttatgtttatgaaccctagtnnnnnnnnntacaagacctctctattattctggctatttatagaagagaggagcgttgggttgtatatagag |
126 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
15350491 |
gtttatgtttatgtttatgaaccctagtaaaaaaaaatacaagacctctctattattctggctatttatagaagagaggagtgttgggttgtataaagag |
15350392 |
T |
 |
| Q |
127 |
agaga |
131 |
Q |
| |
|
||||| |
|
|
| T |
15350391 |
agaga |
15350387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University