View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15106_high_4 (Length: 406)
Name: NF15106_high_4
Description: NF15106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15106_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 48 - 249
Target Start/End: Complemental strand, 3435592 - 3435390
Alignment:
| Q |
48 |
tattccacgcaatagtatctcttatactctctttaatccaatttttattatcccaaaaataactaatgttgagatttcatttaaaatatatattacgaaa |
147 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3435592 |
tattccatgcaatagtatctcttatactctctttaatccaatttttattatcccaaaaataactaatgttgagattccatttaaaatatatattacgaaa |
3435493 |
T |
|
| Q |
148 |
tcgtt-ttgtaaaaagattcgttttggaaatgaagttggctcctttannnnnnnaatgttattaaaaaactaagtaaactttcatttcttagaacacaca |
246 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3435492 |
tcgttgttgtaaaaagattcgttttggaaatgaagttggctcctttatttttttaatgttattaaaaaactaagtaaactttcatctcttagaacacaca |
3435393 |
T |
|
| Q |
247 |
aat |
249 |
Q |
| |
|
||| |
|
|
| T |
3435392 |
aat |
3435390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 336 - 391
Target Start/End: Complemental strand, 3435304 - 3435249
Alignment:
| Q |
336 |
gttcgttaattttctatccccgtgaccaattacaagcattcaccataccccctatg |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3435304 |
gttcgttaattttctatccccgtgaccaattataagcattcaccataccccctatg |
3435249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University