View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15106_high_7 (Length: 331)
Name: NF15106_high_7
Description: NF15106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15106_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 38 - 315
Target Start/End: Original strand, 679226 - 679491
Alignment:
| Q |
38 |
atcacatgccatgccacacagacggcacgagcgagcgtgaataataacaatagattaacaagtataataattataattatannnnnnnnactttaccaga |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
679226 |
atcacatgccatgccacacagacggcacgagcgagcgtgaataataacaatagattaacaagtataat-----taatta-----------ctttaccaga |
679309 |
T |
|
| Q |
138 |
accaaaaccctgttttgcggcacccatatataaaccttactcaaccaaagtccttagttgtgcaatcaaagcaaaaccct----caaacaaacacagaga |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
679310 |
accaaaaccctgttttgcggcacccatatataaaccttactcaaccaaagtccttagttgtgcaatcaaagcaaaaccctcaaacaaacaaacacagaga |
679409 |
T |
|
| Q |
234 |
cgcaggcagaagcagaaaaagaggcttatcgatgtcgcagtctttggagcttctgcttatacaattcttgatgccagataac |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
679410 |
cgcaggcagaagcagaaaaagaggcttatcgatgtcgcagtctttggagcttctgcttatacaattcttgatgccagataac |
679491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University