View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15108_high_23 (Length: 240)
Name: NF15108_high_23
Description: NF15108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15108_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 31860573 - 31860488
Alignment:
| Q |
1 |
tttgaaaagtcgaacgatagttaactgctgttgagtcaacgacagtcgacaaaaagtagtttgagaagtaagaaaagtaatatcca |
86 |
Q |
| |
|
|||||||| ||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860573 |
tttgaaaaatcgaacgatggttaaccgccgttgagtcaacgacagtcgacaaaaagtagtttgagaagtaagaaaagtaatatcca |
31860488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 213
Target Start/End: Original strand, 51635159 - 51635244
Alignment:
| Q |
124 |
gtgaaccggttcttgaaagtaccgcgaaccggtacgtacaaaccggggattggcagtttgctacagtgttacacgaattatgttactatg |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | ||| |||||| || || ||| ||||||||| |||||||||||||| |||||| |
|
|
| T |
51635159 |
gtgaaccggttctcaaaagtaccgcgaaccggttcatacgaaccgg---tttgcggttcgctacagtg-tacacgaattatgtgactatg |
51635244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University