View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15108_high_27 (Length: 226)
Name: NF15108_high_27
Description: NF15108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15108_high_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 12608153 - 12607962
Alignment:
| Q |
18 |
aacatcactccaatgtatttcatccaaatcaggttctatggttttacgatcttccctccaaaccacagcagttgctgaggatgtgaacacaactttgtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12608153 |
aacatcactccaatgtatttcatccaaatcaggttctatggttttacgatcttccctccaaaccacagcagttgctgaggatgtgaacacaactttgtct |
12608054 |
T |
|
| Q |
118 |
attgtttctgtttgagcacaagcttcaagcacgttgtgtgctgctctaacttccacgtcagccatatattcctattaccgacacatgttatc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12608053 |
attgtttctgtttgagcacaagcttcaagcacgttgtgtgctgctctaacttccacgtcagccatatattcctattaccgacacatgttatc |
12607962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University