View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15108_low_18 (Length: 286)
Name: NF15108_low_18
Description: NF15108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15108_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 13 - 270
Target Start/End: Original strand, 6381299 - 6381556
Alignment:
| Q |
13 |
tgaagtttttcgattacttctttgcaataaccaaatatttggtgaggaagcaagagggttgccagttttaaccagcaatatggtgagtctcttcttgaag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6381299 |
tgaagtttttcgattacttctttgcaataaccaaatatttggtgaggaagcaagagggttgccagttttaaccagcaatatggtgagtctcttcttgaag |
6381398 |
T |
|
| Q |
113 |
cttaagagatatttaaaatgcttctcaattggtttttggggaacaactatgacgagatggagaccatgcaaatgttcactgtcagtttgaaggcgtggac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6381399 |
cttaagagatatttaaaatgcttctcaattggtttttggggaacaactatgacgagatggagaccatgcaaatgttcactgtcggtttgaaggcgtggac |
6381498 |
T |
|
| Q |
213 |
atgcatcatcccgtggtactatgacgataaaaatcatgtagaggtagggccggcccat |
270 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6381499 |
atgcatcatcctgtggtactatgacgataaaaatcatgtagaggtagggccggcccat |
6381556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University