View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15108_low_23 (Length: 249)
Name: NF15108_low_23
Description: NF15108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15108_low_23 |
 | |
|
| [»] scaffold0627 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0627 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: scaffold0627
Description:
Target: scaffold0627; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 7 - 249
Target Start/End: Complemental strand, 2846 - 2599
Alignment:
| Q |
7 |
tcgaagaatataaacgtgctaacccaatccaatccaagtaagaatatttttctgtcttatattctctctctcattattagtttgtttttaggaatcaatt |
106 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2846 |
tcgaagcaaataaacgtgctaacccaatccaatccaagtaagaatatttttctgtcttatattctctctctcattattagtttgtttttaggaatcaatt |
2747 |
T |
|
| Q |
107 |
tatgtttttgaaaattaaagaatgataa-----------tatacagattgnnnnnnnagaaaaatattaaatgcaattttgagttaaacatagaattgaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2746 |
tatgtttttgaaaattaaagaatgataatatatagagtatatacagattgtttttttag--aaatattaaatgcaattttgagttaaacatagaattgaa |
2649 |
T |
|
| Q |
196 |
gtagagacctttttacgaatttatttcaattgaaatagtatatcttaattttct |
249 |
Q |
| |
|
|| | |||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2648 |
gt----aactttttacaaatttatttgaattgaaatagtatatcttaattttct |
2599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University